Contents

1 Core infrastructure

1.1 Biostrings

DNA, amino acid, and other biological sequences. See earlier example in B.1 Introduction to Bioconductor

1.2 GenomicRanges

GenomicRanges

1.2.1 Range operations

Alt Ranges Algebra

Ranges

  • IRanges
    • start() / end() / width()
    • List-like – length(), subset, etc.
    • ‘metadata’, mcols()
  • GRanges
    • ‘seqnames’ (chromosome), ‘strand’
    • Seqinfo, including seqlevels and seqlengths

Intra-range methods

  • Independent of other ranges in the same object
  • GRanges variants strand-aware
  • shift(), narrow(), flank(), promoters(), resize(), restrict(), trim()
  • See ?"intra-range-methods"

Inter-range methods

  • Depends on other ranges in the same object
  • range(), reduce(), gaps(), disjoin()
  • coverage() (!)
  • see ?"inter-range-methods"

Between-range methods

  • Functions of two (or more) range objects
  • findOverlaps(), countOverlaps(), …, %over%, %within%, %outside%; union(), intersect(), setdiff(), punion(), pintersect(), psetdiff()

Example

library(GenomicRanges)
gr <- GRanges("A", IRanges(c(10, 20, 22), width=5), "+")
shift(gr, 1)                            # intra-range
## GRanges object with 3 ranges and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A  [11, 15]      +
##   [2]        A  [21, 25]      +
##   [3]        A  [23, 27]      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths
range(gr)                               # inter-range
## GRanges object with 1 range and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A  [10, 26]      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths
reduce(gr)                              # inter-range
## GRanges object with 2 ranges and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A  [10, 14]      +
##   [2]        A  [20, 26]      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths
snps <- GRanges("A", IRanges(c(11, 17, 24), width=1))
findOverlaps(snps, gr)                  # between-range
## Hits object with 3 hits and 0 metadata columns:
##       queryHits subjectHits
##       <integer>   <integer>
##   [1]         1           1
##   [2]         3           2
##   [3]         3           3
##   -------
##   queryLength: 3 / subjectLength: 3
setdiff(range(gr), gr)                  # 'introns'
## GRanges object with 1 range and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A  [15, 19]      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths

1.3 GenomicAlignments

Representation of aligned reads. See exercises below.

1.4 SummarizedExperiment

SummarizedExperiment

Alt SummarizedExperiment

1.5 Annotation Resources

Static packages

Web-based resources, e.g., biomaRt, PSICQUIC, GEOquery, …

Genome-scale resources via AnnotationHub

library(AnnotationHub)
hub = AnnotationHub()
## snapshotDate(): 2017-02-07
hub
## AnnotationHub with 37972 records
## # snapshotDate(): 2017-02-07 
## # $dataprovider: BroadInstitute, UCSC, Ensembl, Haemcode, Inparanoid8, ftp://ftp.ncbi.nlm.nih.go...
## # $species: Homo sapiens, Mus musculus, Bos taurus, Pan troglodytes, Danio rerio, Rattus norvegi...
## # $rdataclass: GRanges, BigWigFile, FaFile, TwoBitFile, ChainFile, Rle, Inparanoid8Db, OrgDb, En...
## # additional mcols(): taxonomyid, genome, description, coordinate_1_based, maintainer,
## #   rdatadateadded, preparerclass, tags, rdatapath, sourceurl, sourcetype 
## # retrieve records with, e.g., 'object[["AH2"]]' 
## 
##             title                                               
##   AH2     | Ailuropoda_melanoleuca.ailMel1.69.dna.toplevel.fa   
##   AH3     | Ailuropoda_melanoleuca.ailMel1.69.dna_rm.toplevel.fa
##   AH4     | Ailuropoda_melanoleuca.ailMel1.69.dna_sm.toplevel.fa
##   AH5     | Ailuropoda_melanoleuca.ailMel1.69.ncrna.fa          
##   AH6     | Ailuropoda_melanoleuca.ailMel1.69.pep.all.fa        
##   ...       ...                                                 
##   AH53248 | Ensembl 87 EnsDb for Tarsius Syrichta               
##   AH53249 | Ensembl 87 EnsDb for Tursiops Truncatus             
##   AH53250 | Ensembl 87 EnsDb for Vicugna Pacos                  
##   AH53251 | Ensembl 87 EnsDb for Xiphophorus Maculatus          
##   AH53252 | Ensembl 87 EnsDb for Xenopus Tropicalis
query(hub, c("ensembl", "81.gtf"))
## AnnotationHub with 69 records
## # snapshotDate(): 2017-02-07 
## # $dataprovider: Ensembl
## # $species: Ailuropoda melanoleuca, Anas platyrhynchos, Anolis carolinensis, Astyanax mexicanus,...
## # $rdataclass: GRanges
## # additional mcols(): taxonomyid, genome, description, coordinate_1_based, maintainer,
## #   rdatadateadded, preparerclass, tags, rdatapath, sourceurl, sourcetype 
## # retrieve records with, e.g., 'object[["AH47937"]]' 
## 
##             title                                   
##   AH47937 | Ailuropoda_melanoleuca.ailMel1.81.gtf   
##   AH47938 | Anas_platyrhynchos.BGI_duck_1.0.81.gtf  
##   AH47939 | Anolis_carolinensis.AnoCar2.0.81.gtf    
##   AH47940 | Astyanax_mexicanus.AstMex102.81.gtf     
##   AH47941 | Bos_taurus.UMD3.1.81.gtf                
##   ...       ...                                     
##   AH48001 | Tupaia_belangeri.TREESHREW.81.gtf       
##   AH48002 | Tursiops_truncatus.turTru1.81.gtf       
##   AH48003 | Vicugna_pacos.vicPac1.81.gtf            
##   AH48004 | Xenopus_tropicalis.JGI_4.2.81.gtf       
##   AH48005 | Xiphophorus_maculatus.Xipmac4.4.2.81.gtf
hub[["AH48004"]]
## loading from cache '/home/mtmorgan//.AnnotationHub/54310'
## using guess work to populate seqinfo
## GRanges object with 581787 ranges and 19 metadata columns:
##              seqnames       ranges strand |   source        type     score     phase
##                 <Rle>    <IRanges>  <Rle> | <factor>    <factor> <numeric> <integer>
##        [1] GL172637.1   [ 34, 148]      - |  ensembl        gene      <NA>      <NA>
##        [2] GL172637.1   [ 34, 148]      - |  ensembl  transcript      <NA>      <NA>
##        [3] GL172637.1   [ 34, 148]      - |  ensembl        exon      <NA>      <NA>
##        [4] GL172637.1   [606, 720]      - |  ensembl        gene      <NA>      <NA>
##        [5] GL172637.1   [606, 720]      - |  ensembl  transcript      <NA>      <NA>
##        ...        ...          ...    ... .      ...         ...       ...       ...
##   [581783] GL180121.1 [ 865,  867]      + |  ensembl start_codon      <NA>         0
##   [581784] GL180121.1 [ 992, 1334]      + |  ensembl        exon      <NA>      <NA>
##   [581785] GL180121.1 [ 992, 1334]      + |  ensembl         CDS      <NA>         2
##   [581786] GL180121.1 [1817, 1835]      + |  ensembl        exon      <NA>      <NA>
##   [581787] GL180121.1 [1817, 1835]      + |  ensembl         CDS      <NA>         1
##                       gene_id gene_version   gene_name gene_source   gene_biotype
##                   <character>    <numeric> <character> <character>    <character>
##        [1] ENSXETG00000030486            1          U5     ensembl          snRNA
##        [2] ENSXETG00000030486            1          U5     ensembl          snRNA
##        [3] ENSXETG00000030486            1          U5     ensembl          snRNA
##        [4] ENSXETG00000031766            1          U5     ensembl          snRNA
##        [5] ENSXETG00000031766            1          U5     ensembl          snRNA
##        ...                ...          ...         ...         ...            ...
##   [581783] ENSXETG00000033193            1        <NA>     ensembl protein_coding
##   [581784] ENSXETG00000033193            1        <NA>     ensembl protein_coding
##   [581785] ENSXETG00000033193            1        <NA>     ensembl protein_coding
##   [581786] ENSXETG00000033193            1        <NA>     ensembl protein_coding
##   [581787] ENSXETG00000033193            1        <NA>     ensembl protein_coding
##                 transcript_id transcript_version transcript_name transcript_source
##                   <character>          <numeric>     <character>       <character>
##        [1]               <NA>               <NA>            <NA>              <NA>
##        [2] ENSXETT00000065882                  1          U5-201           ensembl
##        [3] ENSXETT00000065882                  1          U5-201           ensembl
##        [4]               <NA>               <NA>            <NA>              <NA>
##        [5] ENSXETT00000061796                  1          U5-201           ensembl
##        ...                ...                ...             ...               ...
##   [581783] ENSXETT00000053735                  2            <NA>           ensembl
##   [581784] ENSXETT00000053735                  2            <NA>           ensembl
##   [581785] ENSXETT00000053735                  2            <NA>           ensembl
##   [581786] ENSXETT00000053735                  2            <NA>           ensembl
##   [581787] ENSXETT00000053735                  2            <NA>           ensembl
##            transcript_biotype exon_number            exon_id exon_version         protein_id
##                   <character>   <numeric>        <character>    <numeric>        <character>
##        [1]               <NA>        <NA>               <NA>         <NA>               <NA>
##        [2]              snRNA        <NA>               <NA>         <NA>               <NA>
##        [3]              snRNA           1 ENSXETE00000393193            1               <NA>
##        [4]               <NA>        <NA>               <NA>         <NA>               <NA>
##        [5]              snRNA        <NA>               <NA>         <NA>               <NA>
##        ...                ...         ...                ...          ...                ...
##   [581783]     protein_coding           1               <NA>         <NA>               <NA>
##   [581784]     protein_coding           2 ENSXETE00000303775            2               <NA>
##   [581785]     protein_coding           2               <NA>         <NA> ENSXETP00000053735
##   [581786]     protein_coding           3 ENSXETE00000416553            1               <NA>
##   [581787]     protein_coding           3               <NA>         <NA> ENSXETP00000053735
##            protein_version
##                  <numeric>
##        [1]            <NA>
##        [2]            <NA>
##        [3]            <NA>
##        [4]            <NA>
##        [5]            <NA>
##        ...             ...
##   [581783]            <NA>
##   [581784]            <NA>
##   [581785]               2
##   [581786]            <NA>
##   [581787]               2
##   -------
##   seqinfo: 2375 sequences from JGI_4 genome; no seqlengths

2 From files to Bioconductor objects

2.1 BED, GFF, GTF, WIG import and export

Genome annotations: BED, WIG, GTF, etc. files. E.g., GTF:

rtracklayer

2.2 FASTQ files

Sequenced reads: FASTQ files

@ERR127302.1703 HWI-EAS350_0441:1:1:1460:19184#0/1
CCTGAGTGAAGCTGATCTTGATCTACGAAGAGAGATAGATCTTGATCGTCGAGGAGATGCTGACCTTGACCT
+
HHGHHGHHHHHHHHDGG<GDGGE@GDGGD<?B8??ADAD<BE@EE8EGDGA3CB85*,77@>>CE?=896=:
@ERR127302.1704 HWI-EAS350_0441:1:1:1460:16861#0/1
GCGGTATGCTGGAAGGTGCTCGAATGGAGAGCGCCAGCGCCCCGGCGCTGAGCCGCAGCCTCAGGTCCGCCC
+
DE?DD>ED4>EEE>DE8EEEDE8B?EB<@3;BA79?,881B?@73;1?########################

ShortRead

2.3 Aligned reads

Aligned reads: BAM files

GenomicAlignments

Working with large files

2.4 Called variants: VCF files

VariantAnnotation

3 Exercises

3.1 GenomicAlignments

The RNAseqData.HNRNPC.bam.chr14 package is an example of an experiment data package. It contains a subset of BAM files used in a gene knock-down experiment, as described in ?RNAseqData.HNRNPC.bam.chr14. Load the package and get the path to the BAM files.

library(RNAseqData.HNRNPC.bam.chr14)
fls = RNAseqData.HNRNPC.bam.chr14_BAMFILES
basename(fls)
## [1] "ERR127306_chr14.bam" "ERR127307_chr14.bam" "ERR127308_chr14.bam" "ERR127309_chr14.bam"
## [5] "ERR127302_chr14.bam" "ERR127303_chr14.bam" "ERR127304_chr14.bam" "ERR127305_chr14.bam"

Create BamFileList(), basically telling R that these are paths to BAM files rather than, say, text files from a spreadsheet.

library(GenomicAlignments)
bfls = BamFileList(fls)
bfl = bfls[[1]]

Input and explore the aligments. See ?readGAlignments and ?GAlignments for details on how to manipulate these objects.

ga = readGAlignments(bfl)
ga
## GAlignments object with 800484 alignments and 0 metadata columns:
##            seqnames strand       cigar    qwidth     start       end     width     njunc
##               <Rle>  <Rle> <character> <integer> <integer> <integer> <integer> <integer>
##        [1]    chr14      +         72M        72  19069583  19069654        72         0
##        [2]    chr14      +         72M        72  19363738  19363809        72         0
##        [3]    chr14      -         72M        72  19363755  19363826        72         0
##        [4]    chr14      +         72M        72  19369799  19369870        72         0
##        [5]    chr14      -         72M        72  19369828  19369899        72         0
##        ...      ...    ...         ...       ...       ...       ...       ...       ...
##   [800480]    chr14      -         72M        72 106989780 106989851        72         0
##   [800481]    chr14      +         72M        72 106994763 106994834        72         0
##   [800482]    chr14      -         72M        72 106994819 106994890        72         0
##   [800483]    chr14      +         72M        72 107003080 107003151        72         0
##   [800484]    chr14      -         72M        72 107003171 107003242        72         0
##   -------
##   seqinfo: 93 sequences from an unspecified genome
table(strand(ga))
## 
##      +      -      * 
## 400242 400242      0

Many of the reads have cigar “72M”. What does this mean? Can you create a subset of reads that do not have this cigar? Interpret some of the non-72M cigars. Any hint about what these cigars represent?

tail(sort(table(cigar(ga))))
## 
## 18M123N54M 36M123N36M  64M316N8M 38M670N34M 35M123N37M        72M 
##        225        228        261        264        272     603939
ga[cigar(ga) != "72M"]
## GAlignments object with 196545 alignments and 0 metadata columns:
##            seqnames strand       cigar    qwidth     start       end     width     njunc
##               <Rle>  <Rle> <character> <integer> <integer> <integer> <integer> <integer>
##        [1]    chr14      -     64M1I7M        72  19411677  19411747        71         0
##        [2]    chr14      + 55M2117N17M        72  19650072  19652260      2189         1
##        [3]    chr14      - 43M2117N29M        72  19650084  19652272      2189         1
##        [4]    chr14      - 40M2117N32M        72  19650087  19652275      2189         1
##        [5]    chr14      + 38M2117N34M        72  19650089  19652277      2189         1
##        ...      ...    ...         ...       ...       ...       ...       ...       ...
##   [196541]    chr14      -    51M1D21M        72 106950429 106950501        73         0
##   [196542]    chr14      +    31M1I40M        72 106960410 106960480        71         0
##   [196543]    chr14      +    52M1D20M        72 106965156 106965228        73         0
##   [196544]    chr14      -    13M1D59M        72 106965195 106965267        73         0
##   [196545]    chr14      -     6M1D66M        72 106965202 106965274        73         0
##   -------
##   seqinfo: 93 sequences from an unspecified genome

Use the function summarizeJunctions() to identify genomic regions that are spanned by reads with complicated cigars. Can you use the argument with.revmap=TRUE to extract the reads supporting a particular (e.g., first) junction?

summarizeJunctions(ga)
## GRanges object with 4635 ranges and 3 metadata columns:
##          seqnames                 ranges strand |     score plus_score minus_score
##             <Rle>              <IRanges>  <Rle> | <integer>  <integer>   <integer>
##      [1]    chr14   [19650127, 19652243]      * |         4          2           2
##      [2]    chr14   [19650127, 19653624]      * |         1          1           0
##      [3]    chr14   [19652355, 19653624]      * |         8          7           1
##      [4]    chr14   [19652355, 19653657]      * |         1          1           0
##      [5]    chr14   [19653773, 19653892]      * |         9          5           4
##      ...      ...                    ...    ... .       ...        ...         ...
##   [4631]    chr14 [106912703, 106922227]      * |         1          0           1
##   [4632]    chr14 [106938165, 106938301]      * |        10          2           8
##   [4633]    chr14 [106938645, 106944774]      * |        24          7          17
##   [4634]    chr14 [106944969, 106950170]      * |         7          6           1
##   [4635]    chr14 [106950323, 106960260]      * |         1          1           0
##   -------
##   seqinfo: 93 sequences from an unspecified genome
junctions <- summarizeJunctions(ga, with.revmap=TRUE)
ga[ junctions$revmap[[1]] ]
## GAlignments object with 4 alignments and 0 metadata columns:
##       seqnames strand       cigar    qwidth     start       end     width     njunc
##          <Rle>  <Rle> <character> <integer> <integer> <integer> <integer> <integer>
##   [1]    chr14      + 55M2117N17M        72  19650072  19652260      2189         1
##   [2]    chr14      - 43M2117N29M        72  19650084  19652272      2189         1
##   [3]    chr14      - 40M2117N32M        72  19650087  19652275      2189         1
##   [4]    chr14      + 38M2117N34M        72  19650089  19652277      2189         1
##   -------
##   seqinfo: 93 sequences from an unspecified genome

It is possible to do other actions on BAM files, e.g., calculating the ‘coverage’ (reads overlapping each base).

coverage(bfl)$chr14
## integer-Rle of length 107349540 with 493510 runs
##   Lengths: 19069582       72   294083       17       55 ...       72       19       72   346298
##   Values :        0        1        0        1        2 ...        1        0        1        0

3.2 SummarizedExperiment exercise

The airway experiment data package summarizes an RNA-seq experiment investigating human smooth-muscle airway cell lines treated with dexamethasone. Load the library and data set.

library(airway)
data(airway)
airway
## class: RangedSummarizedExperiment 
## dim: 64102 8 
## metadata(1): ''
## assays(1): counts
## rownames(64102): ENSG00000000003 ENSG00000000005 ... LRG_98 LRG_99
## rowData names(0):
## colnames(8): SRR1039508 SRR1039509 ... SRR1039520 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample

airway is an example of the SummarizedExperiment class. Explore its assay() (the matrix of counts of reads overlapping genomic regions of interest in each sample), colData() (a description of each sample), and rowRanges() (a description of each region of interest; here each region is an ENSEMBL gene).

x <- assay(airway)
class(x)
## [1] "matrix"
dim(x)
## [1] 64102     8
head(x)
##                 SRR1039508 SRR1039509 SRR1039512 SRR1039513 SRR1039516 SRR1039517 SRR1039520
## ENSG00000000003        679        448        873        408       1138       1047        770
## ENSG00000000005          0          0          0          0          0          0          0
## ENSG00000000419        467        515        621        365        587        799        417
## ENSG00000000457        260        211        263        164        245        331        233
## ENSG00000000460         60         55         40         35         78         63         76
## ENSG00000000938          0          0          2          0          1          0          0
##                 SRR1039521
## ENSG00000000003        572
## ENSG00000000005          0
## ENSG00000000419        508
## ENSG00000000457        229
## ENSG00000000460         60
## ENSG00000000938          0
colData(airway)
## DataFrame with 8 rows and 9 columns
##            SampleName     cell      dex    albut        Run avgLength Experiment    Sample
##              <factor> <factor> <factor> <factor>   <factor> <integer>   <factor>  <factor>
## SRR1039508 GSM1275862   N61311    untrt    untrt SRR1039508       126  SRX384345 SRS508568
## SRR1039509 GSM1275863   N61311      trt    untrt SRR1039509       126  SRX384346 SRS508567
## SRR1039512 GSM1275866  N052611    untrt    untrt SRR1039512       126  SRX384349 SRS508571
## SRR1039513 GSM1275867  N052611      trt    untrt SRR1039513        87  SRX384350 SRS508572
## SRR1039516 GSM1275870  N080611    untrt    untrt SRR1039516       120  SRX384353 SRS508575
## SRR1039517 GSM1275871  N080611      trt    untrt SRR1039517       126  SRX384354 SRS508576
## SRR1039520 GSM1275874  N061011    untrt    untrt SRR1039520       101  SRX384357 SRS508579
## SRR1039521 GSM1275875  N061011      trt    untrt SRR1039521        98  SRX384358 SRS508580
##               BioSample
##                <factor>
## SRR1039508 SAMN02422669
## SRR1039509 SAMN02422675
## SRR1039512 SAMN02422678
## SRR1039513 SAMN02422670
## SRR1039516 SAMN02422682
## SRR1039517 SAMN02422673
## SRR1039520 SAMN02422683
## SRR1039521 SAMN02422677
rowRanges(airway)
## GRangesList object of length 64102:
## $ENSG00000000003 
## GRanges object with 17 ranges and 2 metadata columns:
##        seqnames               ranges strand |   exon_id       exon_name
##           <Rle>            <IRanges>  <Rle> | <integer>     <character>
##    [1]        X [99883667, 99884983]      - |    667145 ENSE00001459322
##    [2]        X [99885756, 99885863]      - |    667146 ENSE00000868868
##    [3]        X [99887482, 99887565]      - |    667147 ENSE00000401072
##    [4]        X [99887538, 99887565]      - |    667148 ENSE00001849132
##    [5]        X [99888402, 99888536]      - |    667149 ENSE00003554016
##    ...      ...                  ...    ... .       ...             ...
##   [13]        X [99890555, 99890743]      - |    667156 ENSE00003512331
##   [14]        X [99891188, 99891686]      - |    667158 ENSE00001886883
##   [15]        X [99891605, 99891803]      - |    667159 ENSE00001855382
##   [16]        X [99891790, 99892101]      - |    667160 ENSE00001863395
##   [17]        X [99894942, 99894988]      - |    667161 ENSE00001828996
## 
## ...
## <64101 more elements>
## -------
## seqinfo: 722 sequences (1 circular) from an unspecified genome

It’s easy to subset a SummarizedExperiment on rows, columns and assays, e.g., retaining just those samples in the trt level of the dex factor. Accessing elements of the column data is common, so there is a short-cut.

cidx <- colData(airway)$dex %in% "trt"
airway[, cidx]
## class: RangedSummarizedExperiment 
## dim: 64102 4 
## metadata(1): ''
## assays(1): counts
## rownames(64102): ENSG00000000003 ENSG00000000005 ... LRG_98 LRG_99
## rowData names(0):
## colnames(4): SRR1039509 SRR1039513 SRR1039517 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample
## shortcut
airway[, airway$dex %in% "trt"]
## class: RangedSummarizedExperiment 
## dim: 64102 4 
## metadata(1): ''
## assays(1): counts
## rownames(64102): ENSG00000000003 ENSG00000000005 ... LRG_98 LRG_99
## rowData names(0):
## colnames(4): SRR1039509 SRR1039513 SRR1039517 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample

It’s also easy to perform range-based operations on SummarizedExperiment objects, e.g., querying for range of chromosome 14 and then subsetting to contain only genes on this chromosome. Range operations on rows are very common, so there are shortcuts here, too.

chr14 <- as(seqinfo(rowRanges(airway)), "GRanges")["14"]
ridx <- rowRanges(airway) %over% chr14
airway[ridx,]
## class: RangedSummarizedExperiment 
## dim: 2244 8 
## metadata(1): ''
## assays(1): counts
## rownames(2244): ENSG00000006432 ENSG00000009830 ... ENSG00000273259 ENSG00000273307
## rowData names(0):
## colnames(8): SRR1039508 SRR1039509 ... SRR1039520 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample
## shortcut
chr14 <- as(seqinfo(airway), "GRanges")["14"]
airway[airway %over% chr14,]
## class: RangedSummarizedExperiment 
## dim: 2244 8 
## metadata(1): ''
## assays(1): counts
## rownames(2244): ENSG00000006432 ENSG00000009830 ... ENSG00000273259 ENSG00000273307
## rowData names(0):
## colnames(8): SRR1039508 SRR1039509 ... SRR1039520 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample

Use the assay() and rowSums() function to remove all rows from the airway object that have 0 reads overlapping all samples. Summarize the library size (column sums of assay()) and plot a histogram of the distribution of reads per feature of interest.

3.3 Annotation and GenomicFeatures

Load the org package for Homo sapiens.

library(org.Hs.eg.db)

Use select() to annotate the HNRNPC gene symbol with its Entrez identifier and less formal gene name. Create a map between SYMBOL and ENTREZID using mapIds().

select(org.Hs.eg.db, "HNRNPC", c("ENTREZID", "GENENAME"), "SYMBOL")
## 'select()' returned 1:1 mapping between keys and columns
##   SYMBOL ENTREZID                                          GENENAME
## 1 HNRNPC     3183 heterogeneous nuclear ribonucleoprotein C (C1/C2)
sym2eg <- mapIds(org.Hs.eg.db, "HNRNPC", "ENTREZID", "SYMBOL")
## 'select()' returned 1:1 mapping between keys and columns

Load the TxDb package for the UCSC hg19 knownGene track

library(TxDb.Hsapiens.UCSC.hg19.knownGene)
txdb <- TxDb.Hsapiens.UCSC.hg19.knownGene

Extract coordinates of genes, and of exons grouped by gene for the HNRNPC gene.

gns <- genes(txdb)
exonsBy(txdb, "gene")[sym2eg]
## GRangesList object of length 1:
## $3183 
## GRanges object with 19 ranges and 2 metadata columns:
##        seqnames               ranges strand |   exon_id   exon_name
##           <Rle>            <IRanges>  <Rle> | <integer> <character>
##    [1]    chr14 [21677296, 21679465]      - |    184100        <NA>
##    [2]    chr14 [21678927, 21679725]      - |    184101        <NA>
##    [3]    chr14 [21679565, 21679672]      - |    184102        <NA>
##    [4]    chr14 [21679565, 21679725]      - |    184103        <NA>
##    [5]    chr14 [21679969, 21680062]      - |    184104        <NA>
##    ...      ...                  ...    ... .       ...         ...
##   [15]    chr14 [21702237, 21702388]      - |    184114        <NA>
##   [16]    chr14 [21730760, 21730927]      - |    184115        <NA>
##   [17]    chr14 [21731470, 21731495]      - |    184116        <NA>
##   [18]    chr14 [21731826, 21731988]      - |    184117        <NA>
##   [19]    chr14 [21737457, 21737638]      - |    184118        <NA>
## 
## -------
## seqinfo: 93 sequences (1 circular) from hg19 genome

Use the gene coordinates to query the BAM file for a specific genomic region; see ?ScanBamParam() for other ways of restricting data input.

library(Rsamtools)
param <- ScanBamParam(which=gns[sym2eg])
readGAlignments(bfl, param=param)
## GAlignments object with 5422 alignments and 0 metadata columns:
##          seqnames strand       cigar    qwidth     start       end     width     njunc
##             <Rle>  <Rle> <character> <integer> <integer> <integer> <integer> <integer>
##      [1]    chr14      +         72M        72  21677347  21677418        72         0
##      [2]    chr14      +         72M        72  21677352  21677423        72         0
##      [3]    chr14      +         72M        72  21677354  21677425        72         0
##      [4]    chr14      +         72M        72  21677355  21677426        72         0
##      [5]    chr14      +         72M        72  21677373  21677444        72         0
##      ...      ...    ...         ...       ...       ...       ...       ...       ...
##   [5418]    chr14      -         72M        72  21737512  21737583        72         0
##   [5419]    chr14      -         72M        72  21737520  21737591        72         0
##   [5420]    chr14      -         72M        72  21737520  21737591        72         0
##   [5421]    chr14      -         72M        72  21737521  21737592        72         0
##   [5422]    chr14      -         72M        72  21737534  21737605        72         0
##   -------
##   seqinfo: 93 sequences from an unspecified genome

3.4 AnnotationHub

The Roadmap Epigenomics Project generated genome-wide maps of regulatory marks across a number of cell lines.

Retrieve the Epigenome Roadmap table from AnnotationHub…

library(AnnotationHub)
hub <- AnnotationHub()
## snapshotDate(): 2017-02-07
query(hub, c("epigenome", "metadata"))
## AnnotationHub with 1 record
## # snapshotDate(): 2017-02-07 
## # names(): AH41830
## # $dataprovider: BroadInstitute
## # $species: Homo sapiens
## # $rdataclass: data.frame
## # $title: EID_metadata.tab
## # $description: Metadata for EpigenomeRoadMap Project
## # $taxonomyid: 9606
## # $genome: hg19
## # $sourcetype: tab
## # $sourceurl: http://egg2.wustl.edu/roadmap/data/byFileType/metadata/EID_metadata.tab
## # $sourcelastmodifieddate: 2015-02-15
## # $sourcesize: 18035
## # $tags: c("EpigenomeRoadMap", "Metadata") 
## # retrieve record with 'object[["AH41830"]]'
meta <- hub[["AH41830"]]
## loading from cache '/home/mtmorgan//.AnnotationHub/47270'

Explore the metadata to identify a cell line of interest to you; see also the metadata spreadsheet version of the data made available by the Epigenome roadmap project.

table(meta$ANATOMY)
## 
##            ADRENAL              BLOOD               BONE              BRAIN             BREAST 
##                  1                 27                  1                 13                  3 
##             CERVIX                ESC        ESC_DERIVED                FAT           GI_COLON 
##                  1                  8                  9                  3                  3 
##        GI_DUODENUM       GI_ESOPHAGUS       GI_INTESTINE          GI_RECTUM         GI_STOMACH 
##                  2                  1                  3                  3                  4 
##              HEART               IPSC             KIDNEY              LIVER               LUNG 
##                  4                  5                  1                  2                  5 
##             MUSCLE         MUSCLE_LEG              OVARY           PANCREAS           PLACENTA 
##                  7                  1                  1                  2                  2 
##               SKIN             SPLEEN STROMAL_CONNECTIVE             THYMUS           VASCULAR 
##                  8                  1                  2                  2                  2
meta[meta$ANATOMY == "LIVER",]
##      EID      GROUP   COLOR       MNEMONIC                                 STD_NAME
## 64  E066      Other #999999       LIV.ADLT                                    Liver
## 116 E118 ENCODE2012 #000000 LIV.HEPG2.CNCR HepG2 Hepatocellular Carcinoma Cell Line
##                         EDACC_NAME ANATOMY          TYPE     AGE   SEX SOLID_LIQUID ETHNICITY
## 64                     Adult_Liver   LIVER PrimaryTissue Unknown Mixed        SOLID   Unknown
## 116 HepG2_Hepatocellular_Carcinoma   LIVER      CellLine          Male                       
##     SINGLEDONOR_COMPOSITE
## 64                      C
## 116                    SD

Use the ‘EID’ to query for and retrieve the ‘mnemonic’ file summarizing chromatin state

query(hub, c("E118", "mnemonic"))
## AnnotationHub with 1 record
## # snapshotDate(): 2017-02-07 
## # names(): AH46971
## # $dataprovider: BroadInstitute
## # $species: Homo sapiens
## # $rdataclass: GRanges
## # $title: E118_15_coreMarks_mnemonics.bed.gz
## # $description: 15 state chromatin segmentations from EpigenomeRoadMap Project
## # $taxonomyid: 9606
## # $genome: hg19
## # $sourcetype: BED
## # $sourceurl: http://egg2.wustl.edu/roadmap/data/byFileType/chromhmmSegmentations/ChmmModels/cor...
## # $sourcelastmodifieddate: 2013-10-11
## # $sourcesize: 3231313
## # $tags: c("EpigenomeRoadMap", "chromhmmSegmentations", "ChmmModels", "coreMarks",
## #   "E118", "ENCODE2012", "LIV.HEPG2.CNCR", "HepG2 Hepatocellular Carcinoma Cell Line") 
## # retrieve record with 'object[["AH46971"]]'
E118 <- hub[["AH46971"]]
## require("rtracklayer")
## loading from cache '/home/mtmorgan//.AnnotationHub/52411'
E118
## GRanges object with 561497 ranges and 4 metadata columns:
##            seqnames               ranges strand |        abbr                    name
##               <Rle>            <IRanges>  <Rle> | <character>             <character>
##        [1]    chr10     [     1, 113200]      * |    15_Quies           Quiescent/Low
##        [2]    chr10     [113201, 119600]      * | 14_ReprPCWk Weak Repressed PolyComb
##        [3]    chr10     [119601, 120000]      * |   10_TssBiv     Bivalent/Poised TSS
##        [4]    chr10     [120001, 120200]      * |      1_TssA              Active TSS
##        [5]    chr10     [120201, 120400]      * |  2_TssAFlnk     Flanking Active TSS
##        ...      ...                  ...    ... .         ...                     ...
##   [561493]     chrY [58907201, 58967400]      * |    15_Quies           Quiescent/Low
##   [561494]     chrY [58967401, 58972000]      * |       9_Het         Heterochromatin
##   [561495]     chrY [58972001, 58997400]      * |  8_ZNF/Rpts     ZNF genes & repeats
##   [561496]     chrY [58997401, 59033600]      * |       9_Het         Heterochromatin
##   [561497]     chrY [59033601, 59373400]      * |    15_Quies           Quiescent/Low
##                   color_name  color_code
##                  <character> <character>
##        [1]             White     #FFFFFF
##        [2]         Gainsboro     #C0C0C0
##        [3]         IndianRed     #CD5C5C
##        [4]               Red     #FF0000
##        [5]        Orange Red     #FF4500
##        ...               ...         ...
##   [561493]             White     #FFFFFF
##   [561494]     PaleTurquoise     #8A91D0
##   [561495] Medium Aquamarine     #66CDAA
##   [561496]     PaleTurquoise     #8A91D0
##   [561497]             White     #FFFFFF
##   -------
##   seqinfo: 93 sequences (1 circular) from hg19 genome

Explore the object, e.g., tabulating the different chromatin state classifications (in the name column). Subset the object to return, e.g., just those regions marked as ‘Heterochromatin’

table(E118$name)
## 
##                 Active TSS          Bivalent Enhancer        Bivalent/Poised TSS 
##                      20010                      23155                      13214 
##                  Enhancers        Flanking Active TSS  Flanking Bivalent TSS/Enh 
##                     110260                      45115                      15844 
##            Genic enhancers            Heterochromatin              Quiescent/Low 
##                      14995                      31193                      61759 
##         Repressed PolyComb       Strong transcription Transcr. at gene 5' and 3' 
##                      44013                      32522                       2515 
##    Weak Repressed PolyComb         Weak transcription        ZNF genes & repeats 
##                      60867                      83738                       2297
E118[E118$name %in% "Heterochromatin"]
## GRanges object with 31193 ranges and 4 metadata columns:
##           seqnames               ranges strand |        abbr            name    color_name
##              <Rle>            <IRanges>  <Rle> | <character>     <character>   <character>
##       [1]    chr10   [ 140201,  143800]      * |       9_Het Heterochromatin PaleTurquoise
##       [2]    chr10   [ 806201,  807800]      * |       9_Het Heterochromatin PaleTurquoise
##       [3]    chr10   [ 842001,  843800]      * |       9_Het Heterochromatin PaleTurquoise
##       [4]    chr10   [1024601, 1027200]      * |       9_Het Heterochromatin PaleTurquoise
##       [5]    chr10   [1191601, 1192600]      * |       9_Het Heterochromatin PaleTurquoise
##       ...      ...                  ...    ... .         ...             ...           ...
##   [31189]     chrY [58883001, 58885400]      * |       9_Het Heterochromatin PaleTurquoise
##   [31190]     chrY [58890001, 58891000]      * |       9_Het Heterochromatin PaleTurquoise
##   [31191]     chrY [58906401, 58907200]      * |       9_Het Heterochromatin PaleTurquoise
##   [31192]     chrY [58967401, 58972000]      * |       9_Het Heterochromatin PaleTurquoise
##   [31193]     chrY [58997401, 59033600]      * |       9_Het Heterochromatin PaleTurquoise
##            color_code
##           <character>
##       [1]     #8A91D0
##       [2]     #8A91D0
##       [3]     #8A91D0
##       [4]     #8A91D0
##       [5]     #8A91D0
##       ...         ...
##   [31189]     #8A91D0
##   [31190]     #8A91D0
##   [31191]     #8A91D0
##   [31192]     #8A91D0
##   [31193]     #8A91D0
##   -------
##   seqinfo: 93 sequences (1 circular) from hg19 genome

Can you, using a TxDb package and the genes() and subsetByOverlaps() functions, determine how many genes overlap heterochromatic states, or the genes nearest() each enhancer?

3.5 biomaRt

Visit the biomart website and figure out how to browse data to retreive, e.g., genes on chromosmes 21 and 22. You’ll need to browse to the ensembl mart, Homo spaiens data set, establish filters for chromosomes 21 and 22, and then specify that you’d like the Ensembl gene id attribute returned.

Now do the same process in biomaRt:

library(biomaRt)
head(listMarts(), 3)                      ## list marts
head(listDatasets(useMart("ensembl")), 3) ## mart datasets
ensembl <-                                ## fully specified mart
    useMart("ensembl", dataset = "hsapiens_gene_ensembl")

head(listFilters(ensembl), 3)             ## filters
myFilter <- "chromosome_name"
substr(filterOptions(myFilter, ensembl), 1, 50) ## return values
myValues <- c("21", "22")
head(listAttributes(ensembl), 3)          ## attributes
myAttributes <- c("ensembl_gene_id","chromosome_name")

## assemble and query the mart
res <- getBM(attributes =  myAttributes, filters =  myFilter,
             values =  myValues, mart = ensembl)